Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1169827
End position: 1169880
Length: 54

DNA sequence
>NC_018691, from 1169827 to 1169880 (54 bp); Alcanivorax dieselolei B5 TTGTATTGGCGTCGGTGTTGGTAGTGACGTCGGTGTTGGTAGTGGCGTCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1169799-1170599	Sequence	B5T_01083 - Cytidylyltransferase, putative (Protein is coded in complementary strand; from 1170599 to 1169799)