Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1166222
End position: 1166245
Length: 24

DNA sequence
>NC_018691, from 1166222 to 1166245 (24 bp); Alcanivorax dieselolei B5 CCACCACCAGCACCAGCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1165696-1166841	Sequence	B5T_01079 rodA Rod shape-determining protein RodA-like protein (Protein is coded in complementary strand; from 1166841 to 1165696)