Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3652738
End position: 3652765
Length: 28

DNA sequence
>NC_018691, from 3652738 to 3652765 (28 bp); Alcanivorax dieselolei B5 AGTTGACAGTTGATAGTGGACAGTTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3651253-3652866	Sequence	B5T_03274 glpK Glycerol kinase 2 (Protein is coded in complementary strand; from 3652866 to 3651253)