Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4788133
End position: 4788156
Length: 24

DNA sequence
>NC_018691, from 4788133 to 4788156 (24 bp); Alcanivorax dieselolei B5 CCGCCACCACCACCGCCACTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4786324-4788222	Sequence	B5T_04318 - putative secreted protein (Protein is coded in complementary strand; from 4788222 to 4786324)