Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3508534
End position: 3508557
Length: 24

DNA sequence
>NC_018691, from 3508534 to 3508557 (24 bp); Alcanivorax dieselolei B5 GCTGCCGTTGCCGCTGGCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3508326-3520544	Sequence	B5T_03159 - Filamentous hemagglutinin-like protein (Protein is coded in complementary strand; from 3520544 to 3508326)