Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 828482
End position: 828529
Length: 48

DNA sequence
>NC_018678, from 828482 to 828529 (48 bp); Alteromonas macleodii str. English Channel 673 AGGTTATTAAATAGCTTATTAAGTAACTTATTAAATAGCTTATCAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 828023-828496	Sequence	AMEC673_03580 - stringent starvation protein B