Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 4415049
End position: 4415075
Length: 27

DNA sequence
>NC_018678, from 4415049 to 4415075 (27 bp); Alteromonas macleodii str. English Channel 673 CATGCCGCCCATTCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4415044-4416681	Sequence	AMEC673_18745 - chaperonin GroEL (Protein is coded in complementary strand; from 4416681 to 4415044)