Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 4330654
End position: 4330689
Length: 36

DNA sequence
>NC_018678, from 4330654 to 4330689 (36 bp); Alteromonas macleodii str. English Channel 673 ACCGTACTTGCTACCGTGCTTTCTACCGTATTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4330417-4331424	Sequence	AMEC673_18410 - glutamate/valine-rich protein (Protein is coded in complementary strand; from 4331424 to 4330417)