Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 3733267
End position: 3733293
Length: 27

DNA sequence
>NC_018678, from 3733267 to 3733293 (27 bp); Alteromonas macleodii str. English Channel 673 TTCGGCTTTTTCGGCTTCTTGGGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3733009-3734460	Sequence	AMEC673_15975 - ATP-dependent RNA helicase RhlE (Protein is coded in complementary strand; from 3734460 to 3733009)