Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 2805406
End position: 2805429
Length: 24

DNA sequence
>NC_018678, from 2805406 to 2805429 (24 bp); Alteromonas macleodii str. English Channel 673 GCTCTGACTCTGGCTCTGGCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2803287-2807903	Sequence	AMEC673_11995 - AAA ATPase containing von Willebrand factor type A (vWA) (Protein is coded in complementary strand; from 2807903 to 2803287)