Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 1884116
End position: 1884169
Length: 54

DNA sequence
>NC_018678, from 1884116 to 1884169 (54 bp); Alteromonas macleodii str. English Channel 673 CGCTGAAGGCTCTTTACCCGCTGAAGGCTCTGCATCCGCTAAAGGCTCTTTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1883529-1886939	Sequence	AMEC673_07955 - RNase E (Protein is coded in complementary strand; from 1886939 to 1883529)