Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 1868085
End position: 1868108
Length: 24

DNA sequence
>NC_018678, from 1868085 to 1868108 (24 bp); Alteromonas macleodii str. English Channel 673 AAAAGCAAAAGAATAAGCAAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1867998-1868549	Sequence	AMEC673_07880 - nucleoprotein/polynucleotide-associated enzyme