Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 1716653
End position: 1716685
Length: 33

DNA sequence
>NC_018678, from 1716653 to 1716685 (33 bp); Alteromonas macleodii str. English Channel 673 CATGGTTATTTCCTTGTTATTTCCTTGTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1715079-1716656	Sequence	AMEC673_07280 - xanthine/uracil permease family protein (Protein is coded in complementary strand; from 1716656 to 1715079)
ORF... 1716659-1718137	Sequence	AMEC673_07285 - adenosine deaminase (Protein is coded in complementary strand; from 1718137 to 1716659)