Sequence retrieval

Genome: Alteromonas macleodii str. English Channel 673
Start position: 1097243
End position: 1097266
Length: 24

DNA sequence
>NC_018678, from 1097243 to 1097266 (24 bp); Alteromonas macleodii str. English Channel 673 CGTAACCGTAATCGTTACCGTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1089099-1108265	Sequence	AMEC673_04690 - hypothetical protein (Protein is coded in complementary strand; from 1108265 to 1089099)