Sequence retrieval

Genome: Lactobacillus casei W56
Start position: 982887
End position: 982910
Length: 24

DNA sequence
>NC_018641, from 982887 to 982910 (24 bp); Lactobacillus casei W56 GCAATGGCAACGGAAATGGCAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 982845-983954	Sequence	BN194_09970 corA MIT family metal ion transporter CorA (Protein is coded in complementary strand; from 983954 to 982845)