Sequence retrieval

Genome: Lactobacillus casei W56
Start position: 250194
End position: 250238
Length: 45

DNA sequence
>NC_018641, from 250194 to 250238 (45 bp); Lactobacillus casei W56 GCAGCCACCTGTTCAGCAGCCGCTTGTTCTGCTGCAGCCTGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 249810-250565	Sequence	BN194_02560 - hypothetical protein (Protein is coded in complementary strand; from 250565 to 249810)