Sequence retrieval

Genome: Lactobacillus casei W56
Start position: 2331424
End position: 2331465
Length: 42

DNA sequence
>NC_018641, from 2331424 to 2331465 (42 bp); Lactobacillus casei W56 ATAACATCACTACCCTAACATCACTACCCTAACATCACTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2331448-2332242	Sequence	BN194_23350 - hypothetical protein (Protein is coded in complementary strand; from 2332242 to 2331448)