Sequence retrieval

Genome: Lactobacillus casei W56
Start position: 2168343
End position: 2168366
Length: 24

DNA sequence
>NC_018641, from 2168343 to 2168366 (24 bp); Lactobacillus casei W56 TAACCATAACCATAGCCATAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2168316-2169134	Sequence	BN194_21890 - hypothetical protein (Protein is coded in complementary strand; from 2169134 to 2168316)