Sequence retrieval

Genome: Lactobacillus casei W56
Start position: 2121427
End position: 2121471
Length: 45

DNA sequence
>NC_018641, from 2121427 to 2121471 (45 bp); Lactobacillus casei W56 AGCACTACTTGAAGCTGCACTACTTGAAGCTGCACTGCTTGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2121002-2122252	Sequence	BN194_21500 - Surface antigen (Protein is coded in complementary strand; from 2122252 to 2121002)