Sequence retrieval

Genome: Lactobacillus casei W56
Start position: 1166526
End position: 1166549
Length: 24

DNA sequence
>NC_018641, from 1166526 to 1166549 (24 bp); Lactobacillus casei W56 ATCATCATCGTCGTCATCATCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1166203-1167399	Sequence	BN194_11890 - hypothetical protein (Protein is coded in complementary strand; from 1167399 to 1166203)