Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 222521
End position: 222550
Length: 30

DNA sequence
>NC_018624, from 222521 to 222550 (30 bp); Chlamydia psittaci WC CAGGAGCAGGAGAAGGAGGAGGAGTAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 217411-222804	Sequence	B603_0234 - autotransporter beta-domain protein (Protein is coded in complementary strand; from 222804 to 217411)