Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 802390
End position: 802413
Length: 24

DNA sequence
>NC_018624, from 802390 to 802413 (24 bp); Chlamydia psittaci WC CAGCAGCACCAGCACCAGCAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 802146-802541	Sequence	B603_0747 rplL ribosomal protein L7/L12 (Protein is coded in complementary strand; from 802541 to 802146)