Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 635230
End position: 635253
Length: 24

DNA sequence
>NC_018624, from 635230 to 635253 (24 bp); Chlamydia psittaci WC GTTCTTGTACTTGTACTTGTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 634674-635573	Sequence	B603_0616 - hypothetical protein (Protein is coded in complementary strand; from 635573 to 634674)