Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 544168
End position: 544191
Length: 24

DNA sequence
>NC_018624, from 544168 to 544191 (24 bp); Chlamydia psittaci WC TAAATCTATACATCTATAATTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 543156-544187	Sequence	B603_0530 - hypothetical protein
ORF... 544190-545272	Sequence	B603_0531 lpxD UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase (Protein is coded in complementary strand; from 545272 to 544190)