Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 468041
End position: 468064
Length: 24

DNA sequence
>NC_018624, from 468041 to 468064 (24 bp); Chlamydia psittaci WC TGGTGGTGGTGCAGGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 467448-468848	Sequence	B603_0461 - hypothetical protein (Protein is coded in complementary strand; from 468848 to 467448)