Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 313005
End position: 313028
Length: 24

DNA sequence
>NC_018624, from 313005 to 313028 (24 bp); Chlamydia psittaci WC TCCGGTTCCGGCTCAGGTTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 312995-313645	Sequence	B603_0309 - chlamydia polymorphic membrane family protein (Protein is coded in complementary strand; from 313645 to 312995)