Sequence retrieval

Genome: Chlamydia psittaci WC
Start position: 1078971
End position: 1078994
Length: 24

DNA sequence
>NC_018624, from 1078971 to 1078994 (24 bp); Chlamydia psittaci WC CTTTAGGTTTAGCTTTTGCTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1078230-1079459	Sequence	B603_1004 brnQ branched-chain amino acid transport system II carrier protein