Sequence retrieval

Genome: Brachyspira pilosicoli B2904
Start position: 362225
End position: 362254
Length: 30

DNA sequence
>NC_018607, from 362225 to 362254 (30 bp); Brachyspira pilosicoli B2904 TTATATTGTTGTATATTATTTTATATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 362251-362691	Sequence	B2904_orf383 - surface antigen BspA like protein (Protein is coded in complementary strand; from 362691 to 362251)