Sequence retrieval

Genome: Brachyspira pilosicoli B2904
Start position: 2681276
End position: 2681305
Length: 30

DNA sequence
>NC_018607, from 2681276 to 2681305 (30 bp); Brachyspira pilosicoli B2904 TTTTTATATTTGTTTATAATTTTTTCTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2680040-2681488	Sequence	B2904_orf2613 - capsular polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 2681488 to 2680040)