Sequence retrieval

Genome: Brachyspira pilosicoli B2904
Start position: 2029772
End position: 2029801
Length: 30

DNA sequence
>NC_018607, from 2029772 to 2029801 (30 bp); Brachyspira pilosicoli B2904 TCTTTACTTTCCTTTTCTATTTTTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2029150-2029773	Sequence	B2904_orf1966 - phage prohead protease (Protein is coded in complementary strand; from 2029773 to 2029150)
ORF. 2029757-2031052	Sequence	B2904_orf1967 - phage portal protein (Protein is coded in complementary strand; from 2031052 to 2029757)