Sequence retrieval

Genome: Brachyspira pilosicoli B2904
Start position: 1686847
End position: 1686879
Length: 33

DNA sequence
>NC_018607, from 1686847 to 1686879 (33 bp); Brachyspira pilosicoli B2904 TTTATTGTTTTTATATTCTTTTTTTATAGTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1685735-1686925	Sequence	B2904_orf1620 obgE GTPase ObgE (Protein is coded in complementary strand; from 1686925 to 1685735)