Sequence retrieval

Genome: Brachyspira pilosicoli B2904
Start position: 1546825
End position: 1546854
Length: 30

DNA sequence
>NC_018607, from 1546825 to 1546854 (30 bp); Brachyspira pilosicoli B2904 TTTTTATATTTTATTTTATTTTATTCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1546851-1548662	Sequence	B2904_orf1495 - ABC transporter (Protein is coded in complementary strand; from 1548662 to 1546851)