Sequence retrieval

Genome: Brachyspira pilosicoli B2904
Start position: 1014614
End position: 1014643
Length: 30

DNA sequence
>NC_018607, from 1014614 to 1014643 (30 bp); Brachyspira pilosicoli B2904 ATTAGTTATTATAACTTATTATTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1014636-1015679	Sequence	B2904_orf988 - glyceraldehyde-3-phosphate dehydrogenase (Protein is coded in complementary strand; from 1015679 to 1014636)