Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 721652
End position: 721691
Length: 40

DNA sequence
>NC_018587, from 721652 to 721691 (40 bp); Listeria monocytogenes SLCC2755 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 721189-722109	Sequence	LMOSLCC2755_0687 mogR motility gene repressor (Protein is coded in complementary strand; from 722109 to 721189)