Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 623065
End position: 623088
Length: 24

DNA sequence
>NC_018587, from 623065 to 623088 (24 bp); Listeria monocytogenes SLCC2755 TTTGTATTAGTATTGGTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 622645-624084	Sequence	LMOSLCC2755_0588 iap cell wall hydrolases A (Protein is coded in complementary strand; from 624084 to 622645)