Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 353496
End position: 353531
Length: 36

DNA sequence
>NC_018587, from 353496 to 353531 (36 bp); Listeria monocytogenes SLCC2755 GTTTTGTTGCTTGTTTTGTTGCTGTTTTTGTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 353366-354622	Sequence	LMOSLCC2755_0324 vip cell wall surface anchor family protein (Protein is coded in complementary strand; from 354622 to 353366)