Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 2750351
End position: 2750383
Length: 33

DNA sequence
>NC_018587, from 2750351 to 2750383 (33 bp); Listeria monocytogenes SLCC2755 TTTGCTTTTGATTTGTTTTTTATTTACTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2749587-2750984	Sequence	LMOSLCC2755_2676 dgt deoxyguanosinetriphosphate triphosphohydrolase (Protein is coded in complementary strand; from 2750984 to 2749587)