Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 2487400
End position: 2487423
Length: 24

DNA sequence
>NC_018587, from 2487400 to 2487423 (24 bp); Listeria monocytogenes SLCC2755 CTCTTTTACTATTTTACTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2487409-2487684	Sequence	LMOSLCC2755_2408 - hypothetical protein (Protein is coded in complementary strand; from 2487684 to 2487409)