Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 2428583
End position: 2428612
Length: 30

DNA sequence
>NC_018587, from 2428583 to 2428612 (30 bp); Listeria monocytogenes SLCC2755 CTTTTTCATCCTTTTTCCCCCTTTTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2427783-2428592	Sequence	LMOSLCC2755_2353 - polar amino acid ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 2428592 to 2427783)
ORF... 2428609-2429145	Sequence	LMOSLCC2755_2354 - GNAT family acetyltransferase (Protein is coded in complementary strand; from 2429145 to 2428609)