Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 2420895
End position: 2420918
Length: 24

DNA sequence
>NC_018587, from 2420895 to 2420918 (24 bp); Listeria monocytogenes SLCC2755 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2420045-2420956	Sequence	LMOSLCC2755_2344 - indigoidine synthase A family protein (Protein is coded in complementary strand; from 2420956 to 2420045)