Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 2139715
End position: 2139747
Length: 33

DNA sequence
>NC_018587, from 2139715 to 2139747 (33 bp); Listeria monocytogenes SLCC2755 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2139395-2139922	Sequence	LMOSLCC2755_2073 divIVA cell-division initiation protein (Protein is coded in complementary strand; from 2139922 to 2139395)