Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 2054315
End position: 2054359
Length: 45

DNA sequence
>NC_018587, from 2054315 to 2054359 (45 bp); Listeria monocytogenes SLCC2755 TCAGCTTTTTCAGCAGCAGCTTTCTCGGCAGCAGCTTTGTCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2054117-2054836	Sequence	LMOSLCC2755_2001 - LysM domain-containing protein (Protein is coded in complementary strand; from 2054836 to 2054117)