Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 1908234
End position: 1908281
Length: 48

DNA sequence
>NC_018587, from 1908234 to 1908281 (48 bp); Listeria monocytogenes SLCC2755 GCATCCGCATCAGCATCCGCATCAGCATCCGCATCAGCATCCGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1907973-1908569	Sequence	LMOSLCC2755_1858 - cell wall surface anchor family protein , C-terminal part (Protein is coded in complementary strand; from 1908569 to 1907973)