Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 173058
End position: 173111
Length: 54

DNA sequence
>NC_018587, from 173058 to 173111 (54 bp); Listeria monocytogenes SLCC2755 GGGTCAACTGGATCAACCGGATTTACTGGATCAACCGGGTCAACTGGATTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 172872-174137	Sequence	LMOSLCC2755_0174 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 174137 to 172872)