Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 1629915
End position: 1629950
Length: 36

DNA sequence
>NC_018587, from 1629915 to 1629950 (36 bp); Listeria monocytogenes SLCC2755 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1629897-1630352	Sequence	LMOSLCC2755_1611 - hypothetical protein (Protein is coded in complementary strand; from 1630352 to 1629897)