Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 1624752
End position: 1624775
Length: 24

DNA sequence
>NC_018587, from 1624752 to 1624775 (24 bp); Listeria monocytogenes SLCC2755 ATTAGCAATAGCATTATCATTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1624153-1625025	Sequence	LMOSLCC2755_1606 - hypothetical protein (Protein is coded in complementary strand; from 1625025 to 1624153)