Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 1388643
End position: 1388667
Length: 25

DNA sequence
>NC_018587, from 1388643 to 1388667 (25 bp); Listeria monocytogenes SLCC2755 TTTTTTTTATTTTTCTTTCTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1388650-1389477	Sequence	LMOSLCC2755_1382 oxaA2 inner membrane protein OxaA (Protein is coded in complementary strand; from 1389477 to 1388650)