Sequence retrieval

Genome: Listeria monocytogenes SLCC2755
Start position: 1128908
End position: 1128931
Length: 24

DNA sequence
>NC_018587, from 1128908 to 1128931 (24 bp); Listeria monocytogenes SLCC2755 TGCACATGTACATGTACATGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1128872-1128997	Sequence	LMOSLCC2755_1096 - hypothetical protein (Protein is coded in complementary strand; from 1128997 to 1128872)