Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 1851301
End position: 1851360
Length: 60

DNA sequence
>NC_018585, from 1851301 to 1851360 (60 bp); Listeria monocytogenes SLCC2378 CGTCCGCATCAGCGTCCGCATCAGCATCAGCATCAGCGTCCGCATCAGCGTCGGCATCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1850211-1852643	Sequence	LMOSLCC2378_1821 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 1852643 to 1850211)