Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2443765
End position: 2443809
Length: 45

DNA sequence
>NC_018585, from 2443765 to 2443809 (45 bp); Listeria monocytogenes SLCC2378 ATATTTTGTTGAATCTAATTTTGTTGAATCTAGTTTTGTTGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2442446-2443816	Sequence	LMOSLCC2378_2380 - RNA-directed DNA polymerase (reverse transcriptase) domain-containing protein (Protein is coded in complementary strand; from 2443816 to 2442446)